Prostate Cancer Risks

Lets look at the Risk Factors for Prostate Cancer and dissect them for what they are worth. It would appear that there are some with proven as causalities and then other that do not quite carry weight.

Male Genitourinary Tract (Front view)

Male Genitourinary Tract (Side view)

Age.

It is well known in cancer literature that advancing age leads to rising incidence of cancer. This is not organ specific, meaning all organs; breast, prostate, colon etc. are subject to increasing risk of developing cancer. The reasons suspected for this include dysregulation of the genetic system, accumulation of various toxins over time, oxidative stress on the DNA etc.

Some sobering issues have emerged. A new diagnosis of prostate cancer is made every 2-½ minutes and a prostate cancer related death occurs every 16-½ minutes. Prostate cancer affects 1 in 6 males in the US. This is age adjusted as follows:

Age	Incidence
=<40 years	1 in 9422
40 to 59 years	1 in 41
60 to 69 years	1 in 16
70 to 79 years	1 in 8

Overall Risk is 1 in 6

More than 65% of all prostate cancers are diagnosed in men over the age of 65.

Ethnicity: African American males.

African American men have a 19% risk— nearly one in five — will be diagnosed with prostate cancer. This is a 60% higher incidence than in white American male population. The risk in African American males continues to increase with more immediate members having prostate cancer:

 It is 83% with two immediate members and an astronomical 97% with three immediate members of the family having prostate cancer. For every 100,000 African American males 181 will have prostate cancer. Risks are attributed to genetics and dietary factors mostly.

Genetics

Chromosome 1 has a locus HPC-1 (region at 1q24-25) gene that is suspected to play a role in the African American community, especially in early onset of the disease. A few families have demonstrated such a link. 1 in 500 individuals carry the mutated gene. Another gene implicated in familial risk is the HPC-2 gene mutation (1q42.2-43) The genetic risks account for 10% of all prostate cancers.

For those desirous to see the DNA gene sequence it is below:

TGGTAGCAGGTGGCATTTACCGTCAT[A/G]GAGAGCAGGGATCATAACAACCCCC

 @ http://www.ncbi.nlm.nih.gov/snp/74315364

Other prostate cancer risk related genes that have been mapped to two other parts of chromosome 1, as well as to chromosomes 17, 20 and X. Additionally there is some suspicion that the CAG repeat length in exons coding for the androgen receptors might play a role also.  Risk is calculated with this formula:

Diet.

Charred meats, high ingestion of dietary fats and dairy products are implicated with prostate cancer risk. Included in that risk is the low levels of selenium. Dietary agents showing some protection include; green tea, isoflavinoids and soy.  Lycopene found in tomatoes does not seem to have a previously thought beneficial effect based on current data. The recommendations are to increase the fruits and vegetables in the daily diet and reduce animal fat and dairy consumption.

Obvious!

Agent Orange

Men exposed to agent-orange exposure. There are several epidemiological studies that hint at the relationship between Agent Orange (Dioxin) (Defoliant used in Vietnam) and Prostate Cancer. The studies imply but cannot confirm a direct relationship since the studies ask question of possible exposure and therefore it is related to memory recall.

Most studies of Vietnam veterans have not found an excess risk of prostate cancer, but results from a few studies have suggested a possible link. However the Institute of Medicine has determined there is sufficient evidence to correlate between Vietnam Veterans with exposure to Agent Orange and the high risk of Prostate cancer to cover medical care.

Spraying in Vietnam with Agent Orange

Alcohol.

There is insufficient evidence to link alcohol with prostate cancer at this time.

Smoking.

There is insufficient evidence to link smoking as a cause of prostate cancer, but there enough proof that people with prostate cancer have a higher likelihood of death.

Cadmium

Laboratory data implicate cadmium as a prostate carcinogen. Epidemiological studies do not convincingly implicate cadmium as a cause of prostate cancer. More studies are needed to evaluate this compound. Needless to say that exposure should be avoided.

Cadmium

Tire Plant Workers and Fire fighters.

There is insufficient evidence to implicate prostate cancer with this vocation. Based on the known studies in English literature there is some causality with respiratory tract cancers (Lung) and bladder cancer.

Tire factory

Farmers

Farmers are exposed to multiplicity of various chemicals, such as pesticides, herbicides, fertilizers, solvents, engine exhaust gases and organic dust, and biological agents such as zoonotic viruses, bacteria and fungi. The slightly higher risk of prostate cancer is seen in some studies. They are too equivocal and non-specific as to correlation and causality. Although some of the toxins in the herbicides have been implicated in carcinogenesis, the current epidemiological evidence does not support this hypothesis.

Farming

Painters

There is insufficient evidence that painters have a higher risk of prostate cancer. Painters do have a slightly higher risk of developing bladder cancer but no positive association has been implicated with prostate cancer.

Honore Daumier (painter)

The only three hypotheses that have been shown as a correlation and causality are; Age, African American ethnicity and genetics. The fourth possible risk-provoking factor is the dietary intake of fats, dairy products and meats, More and more data seems to support those three. The remainder of the list touted, has little or no evidence of support.


Author recommends that all (readers) individuals who may suspect any such risks in their own lives to consult their personal physician for further clarity and preventative measures.

References:

Carpten et. al; Germline mutations in the ribonuclease L gene in families showing linkage with HPC1, J.. Nature Genetics 30, 181 - 184 (2002)

American Cancer Society.: Cancer Facts and Figures 2010. Atlanta, Ga: American Cancer Society, 2010.

Miller BA, Kolonel LN, Bernstein L, et al., eds.: Racial/Ethnic Patterns of Cancer in the United States 1988-1992. Bethesda, Md: National Cancer Institute, 1996. NIH Pub. No. 96-4104.

Ruijter E, van de Kaa C, Miller G, et al.: Molecular genetics and epidemiology of prostate carcinoma. Endocr Rev 20 (1): 22-45, 1999.

Isaacs SD, Kiemeney LA, Baffoe-Bonnie A, et al.: Risk of cancer in relatives of prostate cancer probands. J Natl Cancer Inst 87 (13): 991-6, 1995.

Ma et al. A systematic review of the effect of diet in prostate cancer prevention and treatment. Journal of Human Nutrition and Dietetics, 2009; 22 (3): 187

Grönberg H, Bergh A, Damber JE, et al.: Cancer risk in families with hereditary prostate carcinoma. Cancer 89 (6): 1315-21, 2000

Verhage BA, Baffoe-Bonnie AB, Baglietto L, et al.: Autosomal dominant inheritance of prostate cancer: a confirmatory study. Urology 57 (1): 97-101, 2001.

Kolonel LN: Fat, meat, and prostate cancer. Epidemiol Rev 23 (1): 72-81, 2001

Sahmoun AE, Case LD, Jackson SA, Schwartz GG;Cadmium and prostate cancer: a critical epidemiologic analysis. Cancer Invest. 2005;23(3):256-63. Department of Internal Medicine, University of North Dakota School of Medicine, Fargo, North Dakota, USA

Vilhjalmur Rafnsson Occup Environ Med 2007;64:143 doi:10.1136/oem.2006.030932

Commentary:Farming and prostate cancer

Marie-Elise Parent1 and Jack Siemiatycki, Occupation and Prostate Cancer; Epidemiol Rev Vol. 23, No. 1, 2001

Acquavella JF. Farming and prostate cancer. Epidemiology

1999;10:349-51.